QPRT Knockout Cell Line - CD BioSciences

service-banner

QPRT Knockout Cell Line

QPRT Knockout Cell Line

SPL-02912

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name QPRT
Gene Abbr. QPRT
Gene ID 23475
Full Name quinolinate phosphoribosyltransferase
Alias HEL-S-90n, QPRTase
Species Human
Genomic Locus chr16:29694774
Transcript NM_014298
WT Expression Level 47.36 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of QPRT.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GCCCACAGCGCCGCCTGCGA
PCR Primer Forward: TCCCAGTTTCACTGGTTGTTAAATA
Reverse: TGGTTATCCTTCACCATCACCAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.