PYCARD Knockout Cell Line - CD BioSciences

service-banner

PYCARD Knockout Cell Line

PYCARD Knockout Cell Line

SPL-02908

Size Price
1 Unit Online Inquiry
Description
71bp deletion
Target Information
Target Name PYCARD
Gene Abbr. PYCARD
Gene ID 29108
Full Name PYD and CARD domain containing
Alias ASC, CARD5, TMS, TMS-1, TMS1
Species Human
Genomic Locus chr16:31202543
Transcript NM_013258
WT Expression Level 9.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes an adaptor protein that is composed of two protein-protein interaction domains: a N-terminal PYRIN-PAAD-DAPIN domain (PYD) and a C-terminal caspase-recruitment domain (CARD). The PYD and CARD domains are members of the six-helix bundle death domain-fold superfamily that mediates assembly of large signaling complexes in the inflammatory and apoptotic signaling pathways via the activation of caspase. In normal cells, this protein is localized to the cytoplasm; however, in cells undergoing apoptosis, it forms ball-like aggregates near the nuclear periphery. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 71bp deletion in a coding exon of PYCARD.
Description 71bp deletion
Parental Cell Line C631
Guide RNA Sequence GCTGCTGTCCATGGACGCCT
PCR Primer Forward: GTCCCGTTGGTCGGTAGG
Reverse: CTTTTGCTGGAGGGCAACG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.