Online Inquiry
PYCARD Knockout Cell Line
SPL-02908
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
71bp deletion |
Target Information | |
---|---|
Target Name | PYCARD |
Gene Abbr. | PYCARD |
Gene ID | 29108 |
Full Name | PYD and CARD domain containing |
Alias | ASC, CARD5, TMS, TMS-1, TMS1 |
Species | Human |
Genomic Locus | chr16:31202543 |
Transcript | NM_013258 |
WT Expression Level | 9.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes an adaptor protein that is composed of two protein-protein interaction domains: a N-terminal PYRIN-PAAD-DAPIN domain (PYD) and a C-terminal caspase-recruitment domain (CARD). The PYD and CARD domains are members of the six-helix bundle death domain-fold superfamily that mediates assembly of large signaling complexes in the inflammatory and apoptotic signaling pathways via the activation of caspase. In normal cells, this protein is localized to the cytoplasm; however, in cells undergoing apoptosis, it forms ball-like aggregates near the nuclear periphery. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 71bp deletion in a coding exon of PYCARD. |
Description | 71bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCTGCTGTCCATGGACGCCT |
PCR Primer |
Forward: GTCCCGTTGGTCGGTAGG Reverse: CTTTTGCTGGAGGGCAACG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.