Online Inquiry
PXN cDNA ORF Clone, Human, untagged
SPD-11227
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human paxillin, transcript variant 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Paxillin |
| Gene Abbr. | PXN |
| Gene ID | 5829 |
| Full Name | paxillin |
| Introduction | Paxillin is a multidomain protein that localizes primarily to focal adhesion sites in the extracellular matrix. Paxillin is one of the key components of integrin signaling, and tyrosine phosphorylation of paxillin is required for integrin-mediated cytoskeletal reorganization. Paxillin is phosphorylated by another focal adhesion component, focal adhesion kinase (FAK), at Tyr118. Phospho-Paxillin (Tyr118) may provide a docking site for recruitment of other signaling molecules to focal adhesions. It has been shown that the SH2 domain of Crk binds to the phosphorylated Tyr118 of paxillin. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human paxillin, transcript variant 1. |
| NCBI Ref Seq | NM_002859.1 |
| RefSeq ORF Size | 1674 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.67kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.