Online Inquiry
PVR Knockout Cell Line
SPL-02901
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 166bp insertion |
| Target Information | |
|---|---|
| Target Name | PVR |
| Gene Abbr. | PVR |
| Gene ID | 5817 |
| Full Name | PVR cell adhesion molecule |
| Alias | CD155, HVED, NECL5, Necl-5, PVS |
| Species | Human |
| Genomic Locus | chr19:44647278 |
| Transcript | NM_006505 |
| WT Expression Level | 62.23 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 166bp insertion in a coding exon of PVR. |
| Description | 166bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACGCTGCCCTGCTACCTAC |
| PCR Primer |
Forward: TGGAGCCCCTCCCTATCTAGTC Reverse: GGTGTAGTTGCCTTCATCCTCTAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.