Online Inquiry
PTPRC Knockout Cell Line
SPL-02894
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp deletion |
Target Information | |
---|---|
Target Name | CD45RO |
Gene Abbr. | PTPRC |
Gene ID | 5788 |
Full Name | protein tyrosine phosphatase receptor type C |
Alias | B220, CD45, CD45R, GP180, L-CA |
Species | Human |
Genomic Locus | chr1:198703308 |
Transcript | NM_002838 |
WT Expression Level | 0.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of PTPRC. |
Description | 1bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TGGTTGTTTCAGAGGCATTA |
PCR Primer |
Forward: AAACAAGCGAATGTCAAATCAAACG Reverse: ATCACCCTCAGGATTCAAACACTTA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.