PTEN Knockout Cell Line - CD BioSciences

service-banner

PTEN Knockout Cell Line

PTEN Knockout Cell Line

SPL-02872

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name PTEN
Gene Abbr. PTEN
Gene ID 5728
Full Name phosphatase and tensin homolog
Alias 10q23del, BZS, CWS1, DEC, GLM2
Species Human
Genomic Locus chr10:87864480
Transcript NM_000314
WT Expression Level 37.21 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PTEN.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence GCTAACGATCTCTTTGATGA
PCR Primer Forward: AGGATTATTCGTCTTCTCCCCATTC
Reverse: CCACGTTCTAAGAGAGTGACAGAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.