Online Inquiry
PTEN Knockout Cell Line
SPL-02871
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp insertion |
Target Information | |
---|---|
Target Name | PTEN |
Gene Abbr. | PTEN |
Gene ID | 5728 |
Full Name | phosphatase and tensin homolog |
Alias | 10q23del, BZS, CWS1, DEC, GLM2 |
Species | Human |
Genomic Locus | chr10:87894064 |
Transcript | NM_000314 |
WT Expression Level | 37.21 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PTEN. |
Description | 1bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | AAAGACTTGAAGGCGTATAC |
PCR Primer |
Forward: ATCAAATGAACTGTATCCCCCTGAA Reverse: TACTCCAGCTATAGTGGGGAAAACT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.