Online Inquiry
PTEN cDNA ORF Clone, Human, C-FLAG tag
SPD-11943
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human phosphatase and tensin homolog (PTEN) with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PTEN |
| Gene Abbr. | PTEN |
| Gene ID | 5728 |
| Full Name | phosphatase and tensin homolog |
| Alias | 10q23del, BZS, CWS1, DEC, GLM2 |
| Introduction | PTEN (phosphatase and tensin homologue deleted on chromosome ten), also referred to as MMAC (mutated in multiple advanced cancers) phosphatase, is a tumor suppressor implicated in a wide variety of human cancers. PTEN encodes a 403 amino acid polypeptide originally described as a dual-specificity protein phosphatase. The main substrates of PTEN are inositol phospholipids generated by the activation of the phosphoinositide 3-kinase (PI3K). PTEN is a major negative regulator of the PI3K/Akt signaling pathway. PTEN possesses a carboxy-terminal, noncatalytic regulatory domain with three phosphorylation sites (Ser380, Thr382, and Thr383) that regulate PTEN stability and may affect its biological activity. PTEN regulates p53 protein levels and activity and is involved in G protein-coupled signaling during chemotaxis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human phosphatase and tensin homolog (PTEN) with C terminal Flag tag. |
| NCBI Ref Seq | NM_000314.4 |
| RefSeq ORF Size | 1212 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 1.26kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.