Online Inquiry
PSMF1 Knockout Cell Line
SPL-02869
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | PSMF1 |
| Gene Abbr. | PSMF1 |
| Gene ID | 9491 |
| Full Name | proteasome inhibitor subunit 1 |
| Alias | PI31 |
| Species | Human |
| Genomic Locus | chr20:1125569 |
| Transcript | NM_006814 |
| WT Expression Level | 194.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a protein that inhibits the activation of the proteasome by the 11S and 19S regulators. Alternative transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of PSMF1. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CATCCTTATACTCATACCGG |
| PCR Primer |
Forward: ATTTCTCTTGACCTCCACATCTTCA Reverse: ATCACTAGGTAAGGGCTACATGAAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.