Online Inquiry
PSMB8 Knockout Cell Line
SPL-02855
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PSMB8 |
| Gene Abbr. | PSMB8 |
| Gene ID | 5696 |
| Full Name | proteasome 20S subunit beta 8 |
| Alias | ALDD, D6S216, D6S216E, JMP, LMP7 |
| Species | Human |
| Genomic Locus | chr6:32843032 |
| Transcript | NM_148919 |
| WT Expression Level | 61.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 3 (proteasome beta 5 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. Two alternative transcripts encoding two isoforms have been identified; both isoforms are processed to yield the same mature subunit. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PSMB8. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAGGAACGTTCAGATTGAGA |
| PCR Primer |
Forward: ATAGATCCCCCAGTGTGTCCTAAAT Reverse: TAAAACCTTTTCCTGGAGCCTCTTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.