Psenen cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Psenen cDNA ORF Clone, Mouse, untagged

Psenen cDNA ORF Clone, Mouse, untagged

SPD-11331

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse presenilin enhancer 2 homolog (C. elegans).
Target Information
Species Mouse
Target Name PEN2
Gene Abbr. Psenen
Gene ID 66340
Full Name presenilin enhancer gamma secretase subunit
Alias 1700023M09Rik, Pen-2
Introduction Nicastrin is a transmembrane glycoprotein serving as an essential component of the γ-secretase complex. Nicastrin is physically associated with presenilin and plays an important role in the stabilization and correct localization of presenilin to the membrane-bound γ-secretase complex. Nicastrin also serves as a docking site for γ-secretase substrates such as APP and Notch, directly binding to them and properly presenting them to γ-secretase to ensure the correct cleavage process.
Product Details
Description Full length Clone DNA of Mouse presenilin enhancer 2 homolog (C. elegans).
NCBI Ref Seq NM_025498.2
RefSeq ORF Size 306 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.