PSENEN cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

PSENEN cDNA ORF Clone, Human, C-Myc tag

PSENEN cDNA ORF Clone, Human, C-Myc tag

SPD-11334

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human presenilin enhancer gamma secretase subunit with C terminal Myc tag.
Target Information
Species Human
Target Name PEN2
Gene Abbr. PSENEN
Gene ID 55851
Full Name presenilin enhancer, gamma-secretase subunit
Alias ACNINV2, MDS033, MSTP064, PEN-2, PEN2
Introduction Nicastrin is a transmembrane glycoprotein serving as an essential component of the γ-secretase complex. Nicastrin is physically associated with presenilin and plays an important role in the stabilization and correct localization of presenilin to the membrane-bound γ-secretase complex. Nicastrin also serves as a docking site for γ-secretase substrates such as APP and Notch, directly binding to them and properly presenting them to γ-secretase to ensure the correct cleavage process.
Product Details
Description Full length Clone DNA of Human presenilin enhancer gamma secretase subunit with C terminal Myc tag.
NCBI Ref Seq NM_172341.2
RefSeq ORF Size 351 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.35kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.