Online Inquiry
PSENEN cDNA ORF Clone, Human, C-FLAG tag
SPD-11332
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human presenilin enhancer gamma secretase subunit with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PEN2 |
| Gene Abbr. | PSENEN |
| Gene ID | 55851 |
| Full Name | presenilin enhancer, gamma-secretase subunit |
| Alias | ACNINV2, MDS033, MSTP064, PEN-2, PEN2 |
| Introduction | Nicastrin is a transmembrane glycoprotein serving as an essential component of the γ-secretase complex. Nicastrin is physically associated with presenilin and plays an important role in the stabilization and correct localization of presenilin to the membrane-bound γ-secretase complex. Nicastrin also serves as a docking site for γ-secretase substrates such as APP and Notch, directly binding to them and properly presenting them to γ-secretase to ensure the correct cleavage process. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human presenilin enhancer gamma secretase subunit with C terminal Flag tag. |
| NCBI Ref Seq | NM_172341.2 |
| RefSeq ORF Size | 345 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 0.35kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.