PRPF40B Knockout Cell Line - CD BioSciences

service-banner

PRPF40B Knockout Cell Line

PRPF40B Knockout Cell Line

SPL-02839

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name PRPF40B
Gene Abbr. PRPF40B
Gene ID 25766
Full Name pre-mRNA processing factor 40 homolog B
Alias HYPC
Species Human
Genomic Locus chr12:49633494
Transcript NM_001031698
WT Expression Level 5.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and methyl CpG binding protein 2 (MeCP2). Alternative splicing results in different transcript variants. [provided by RefSeq, Aug 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PRPF40B.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence ACCAGAGTAAAGAGTCCCGC
PCR Primer Forward: CTAAAGGTTCCTGTGTCCTCTACTC
Reverse: TGGGAAAAGATAACACAGTCAGTCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.