Online Inquiry
PROS1 Knockout Cell Line
SPL-02838
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp deletion |
Target Information | |
---|---|
Target Name | PROS1 |
Gene Abbr. | PROS1 |
Gene ID | 5627 |
Full Name | protein S |
Alias | PROS, PS21, PS22, PS23, PS24 |
Species | Human |
Genomic Locus | chr3:93927357 |
Transcript | NM_000313 |
WT Expression Level | 4.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. It is found in plasma in both a free, functionally active form and also in an inactive form complexed with C4b-binding protein. Mutations in this gene result in autosomal dominant hereditary thrombophilia. An inactive pseudogene of this locus is located at an adjacent region on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PROS1. |
Description | 2bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTGCACGACGCTTCCTAACC |
PCR Primer |
Forward: TTCCATAAATGCTTACCGTTTCCG Reverse: TCTGAATTGTTAACCAACGTGCTTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.