PROS1 Knockout Cell Line - CD BioSciences

service-banner

PROS1 Knockout Cell Line

PROS1 Knockout Cell Line

SPL-02838

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name PROS1
Gene Abbr. PROS1
Gene ID 5627
Full Name protein S
Alias PROS, PS21, PS22, PS23, PS24
Species Human
Genomic Locus chr3:93927357
Transcript NM_000313
WT Expression Level 4.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. It is found in plasma in both a free, functionally active form and also in an inactive form complexed with C4b-binding protein. Mutations in this gene result in autosomal dominant hereditary thrombophilia. An inactive pseudogene of this locus is located at an adjacent region on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PROS1.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TTGCACGACGCTTCCTAACC
PCR Primer Forward: TTCCATAAATGCTTACCGTTTCCG
Reverse: TCTGAATTGTTAACCAACGTGCTTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.