PRNP Knockout Cell Line - CD BioSciences

service-banner

PRNP Knockout Cell Line

PRNP Knockout Cell Line

SPL-02835

Size Price
1 Unit Online Inquiry
Description
19bp deletion
Target Information
Target Name PRNP
Gene Abbr. PRNP
Gene ID 5621
Full Name prion protein
Alias ASCR, AltPrP, CD230, CJD, GSS
Species Human
Genomic Locus chr20:4699507
Transcript NM_183079
WT Expression Level 57.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of PRNP.
Description 19bp deletion
Parental Cell Line C631
Guide RNA Sequence CGGCTTGTTCCACTGACTGT
PCR Primer Forward: GAAGCCTGGAGGATGGAACACT
Reverse: CATGTTTTCACGATAGTAACGGTCC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.