Online Inquiry
PRMT6 Knockout Cell Line
SPL-02830
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | PRMT6 |
| Gene Abbr. | PRMT6 |
| Gene ID | 55170 |
| Full Name | protein arginine methyltransferase 6 |
| Alias | HRMT1L6 |
| Species | Human |
| Genomic Locus | chr1:107057032 |
| Transcript | NM_018137 |
| WT Expression Level | 17.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the arginine N-methyltransferase family, which catalyze the sequential transfer of methyl group from S-adenosyl-L-methionine to the side chain nitrogens of arginine residues within proteins, to form methylated arginine derivatives and S-adenosyl-L-homocysteine. This protein can catalyze both, the formation of omega-N monomethylarginine and asymmetrical dimethylarginine, with a strong preference for the latter. It specifically mediates the asymmetric dimethylation of Arg2 of histone H3, and the methylated form represents a specific tag for epigenetic transcriptional repression. This protein also forms a complex with, and methylates DNA polymerase beta, resulting in stimulation of polymerase activity by enhancing DNA binding and processivity. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of PRMT6. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTCTACCGCGTACACGCGCC |
| PCR Primer |
Forward: GGAGGGAACTGAAGAGGAAGATGG Reverse: ACCTGTTCCGGCAACTCTAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.