Online Inquiry
PRLR Knockout Cell Line
SPL-02825
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 25bp deletion |
| Target Information | |
|---|---|
| Target Name | PRLR |
| Gene Abbr. | PRLR |
| Gene ID | 5618 |
| Full Name | prolactin receptor |
| Alias | HPRL, MFAB, RI-PRLR, hPRLrI |
| Species | Human |
| Genomic Locus | chr5:35072668 |
| Transcript | NM_000949 |
| WT Expression Level | 5.62 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of PRLR. |
| Description | 25bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AACCCTACCTGTGGATTAAA |
| PCR Primer |
Forward: TGTTTTCAGTTGTGAGGGCTTTATC Reverse: TAGTACAGTGGGAAGAGTGAGATGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.