Online Inquiry
PRKX Knockout Cell Line
SPL-02823
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | PRKX |
| Gene Abbr. | PRKX |
| Gene ID | 5613 |
| Full Name | protein kinase X-linked |
| Alias | PKX1 |
| Species | Human |
| Genomic Locus | chrX:3674653 |
| Transcript | NM_005044 |
| WT Expression Level | 19.50 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a serine threonine protein kinase that has similarity to the catalytic subunit of cyclic AMP dependent protein kinases. The encoded protein is developmentally regulated and may be involved in renal epithelial morphogenesis. This protein may also be involved in macrophage and granulocyte maturation. Abnormal recombination between this gene and a related pseudogene on chromosome Y is a frequent cause of sex reversal disorder in XX males and XY females. Pseudogenes of this gene are found on chromosomes X, 15 and Y. [provided by RefSeq, Feb 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of PRKX. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTGTTGCTCCTGCTTTAGG |
| PCR Primer |
Forward: TTATAAGAAGAGACACACAGGGGTC Reverse: CTCTGTCGATTTCTTCTCTCTCCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.