Online Inquiry
PRKN Knockout Cell Line
SPL-02821
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | Parkin |
| Gene Abbr. | PRKN |
| Gene ID | 5071 |
| Full Name | parkin RBR E3 ubiquitin protein ligase |
| Alias | AR-JP, LPRS2, PARK2, PDJ |
| Species | Human |
| Genomic Locus | chr6:161973337 |
| Transcript | NM_013988 |
| WT Expression Level | 1.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of PARK2. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACCTGATCGCAACAAATAGT |
| PCR Primer |
Forward: ACAATATTGGGAAAGTAAGGAGGGG Reverse: TCACACCTCGTAACAGATTTCTTCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.