Prkg2 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Prkg2 cDNA ORF Clone, Mouse, untagged

Prkg2 cDNA ORF Clone, Mouse, untagged

SPD-11871

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse protein kinase, cGMP-dependent, type II.
Target Information
Species Mouse
Target Name PRKG2
Gene Abbr. Prkg2
Gene ID 19092
Full Name protein kinase, cGMP-dependent, type II
Alias AW212535, CGKII, Prk, Prkgr2, cGK-
Product Details
Description Full length Clone DNA of Mouse protein kinase, cGMP-dependent, type II.
NCBI Ref Seq NM_008926.4
RefSeq ORF Size 2289 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.