Online Inquiry
PRKD3 Knockout Cell Line
SPL-02813
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PKC |
| Gene Abbr. | PRKD3 |
| Gene ID | 23683 |
| Full Name | protein kinase D3 |
| Alias | EPK2, PKC-NU, PKD3, PRKCN, nPKC-NU |
| Species | Human |
| Genomic Locus | chr2:37316409 |
| Transcript | NM_005813 |
| WT Expression Level | 28.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene belongs to the multigene protein kinase D family of serine/threonine kinases, which bind diacylglycerol and phorbol esters. Members of this family are characterized by an N-terminal regulatory domain comprised of a tandem repeat of cysteine-rich zinc-finger motifs and a pleckstrin domain. The C-terminal region contains the catalytic domain and is distantly related to calcium-regulated kinases. Catalytic activity of this enzyme promotes its nuclear localization. This protein has been implicated in a variety of functions including negative regulation of human airway epithelial barrier formation, growth regulation of breast and prostate cancer cells, and vesicle trafficking. [provided by RefSeq, Jan 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PRKD3. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGGGCAGAGAGTCCCGTCTT |
| PCR Primer |
Forward: AGGCCAATTTGCAGTAGAAATGAAA Reverse: CAGATGTCTGCAAATAATTCCCCTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.