PRKD2 Knockout Cell Line - CD BioSciences

service-banner

PRKD2 Knockout Cell Line

PRKD2 Knockout Cell Line

SPL-02811

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name PKC
Gene Abbr. PRKD2
Gene ID 25865
Full Name protein kinase D2
Alias HSPC187, PKD2, nPKC-D2
Species Human
Genomic Locus chr19:46710924
Transcript NM_001079882
WT Expression Level 21.19 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of PRKD2.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence CTCTTCGGCCTAGTGCGCCA
PCR Primer Forward: CCCATTATTACTTCCTAGGCTGCG
Reverse: ATCCACCCCTATTTTCCGCCTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.