Online Inquiry
PRKCZ Knockout Cell Line
SPL-02807
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 26bp deletion |
| Target Information | |
|---|---|
| Target Name | PKC |
| Gene Abbr. | PRKCZ |
| Gene ID | 5590 |
| Full Name | protein kinase C zeta |
| Alias | PKC-ZETA, PKC2 |
| Species | Human |
| Genomic Locus | chr1:2148900 |
| Transcript | NM_002744 |
| WT Expression Level | 21.21 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of PRKCZ. |
| Description | 26bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGACAGCATTAAAGACGACT |
| PCR Primer |
Forward: TATGTCACGAATGTACATCCCCAG Reverse: CCGGACCATGTCTATTTCACATCTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.