PRKCZ Knockout Cell Line - CD BioSciences

service-banner

PRKCZ Knockout Cell Line

PRKCZ Knockout Cell Line

SPL-02806

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name PKC
Gene Abbr. PRKCZ
Gene ID 5590
Full Name protein kinase C zeta
Alias PKC-ZETA, PKC2
Species Human
Genomic Locus chr1:2148900
Transcript NM_002744
WT Expression Level 21.21 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of PRKCZ.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence TGACAGCATTAAAGACGACT
PCR Primer Forward: TATGTCACGAATGTACATCCCCAG
Reverse: CCGGACCATGTCTATTTCACATCTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.