PRKCE Knockout Cell Line - CD BioSciences

service-banner

PRKCE Knockout Cell Line

PRKCE Knockout Cell Line

SPL-02799

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name PKC
Gene Abbr. PRKCE
Gene ID 5581
Full Name protein kinase C epsilon
Alias PKCE, nPKC-epsilon
Species Human
Genomic Locus chr2:46001423
Transcript NM_005400
WT Expression Level 1.68 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of PRKCE.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence CCGTCGATGTGAGACCAACG
PCR Primer Forward: GAAAGGATGGCTGGAATGAA
Reverse: ACAGCAAGCCTCAAGGGTTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.