Online Inquiry
PRKCD Knockout Cell Line
SPL-02798
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp insertion |
| Target Information | |
|---|---|
| Target Name | PKC |
| Gene Abbr. | PRKCD |
| Gene ID | 5580 |
| Full Name | protein kinase C delta |
| Alias | ALPS3, CVID9, MAY1, PKCD, nPKC-delta |
| Species | Human |
| Genomic Locus | chr3:53179671 |
| Transcript | NM_006254 |
| WT Expression Level | 22.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp insertion in a coding exon of PRKCD. |
| Description | 4bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGCCCGCATTAGCACAATC |
| PCR Primer |
Forward: CTCTAGAGGACACTGGGGAACC Reverse: ATTTAGTAGCGCCTTCCCTTAACAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.