Online Inquiry
PRKAG2 Knockout Cell Line
SPL-02794
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | AMPK |
| Gene Abbr. | PRKAG2 |
| Gene ID | 51422 |
| Full Name | protein kinase AMP-activated non-catalytic subunit gamma 2 |
| Alias | AAKG, AAKG2, CMH6, H91620p, WPWS |
| Species | Human |
| Genomic Locus | chr7:151595364 |
| Transcript | NM_024429 |
| WT Expression Level | 12.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | AMP-activated protein kinase (AMPK) is a heterotrimeric protein composed of a catalytic alpha subunit, a noncatalytic beta subunit, and a noncatalytic regulatory gamma subunit. Various forms of each of these subunits exist, encoded by different genes. AMPK is an important energy-sensing enzyme that monitors cellular energy status and functions by inactivating key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This gene is a member of the AMPK gamma subunit family. Mutations in this gene have been associated with Wolff-Parkinson-White syndrome, familial hypertrophic cardiomyopathy, and glycogen storage disease of the heart. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of PRKAG2. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACAACAAGCTTTGAACTGGT |
| PCR Primer |
Forward: ATTTGAGCTTCCCTGTCTTTAGGAA Reverse: CTGGGACCTCCAATATAGTGTTCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.