Prkag2 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Prkag2 cDNA ORF Clone, Mouse, N-FLAG tag

Prkag2 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-00591

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse protein kinase, AMP-activated, gamma 2 non-catalytic subunit with N terminal Flag tag.
Target Information
Species Mouse
Target Name AMPK
Gene Abbr. Prkag2
Gene ID 108099
Full Name protein kinase, AMP-activated, gamma 2 non-catalytic subunit
Alias 2410051C13Rik, AAKG, AAKG2, AI854673, H91620p
Introduction AMP-activated protein kinase (AMPK) is highly conserved from yeast to plants and animals and plays a key role in the regulation of energy homeostasis. AMPK is a heterotrimeric complex composed of a catalytic α subunit and regulatory β and γ subunits, each of which is encoded by two or three distinct genes (α1, 2; β1, 2; γ1, 2, 3). The kinase is activated by an elevated AMP/ATP ratio due to cellular and environmental stress, such as heat shock, hypoxia, and ischemia. The tumor suppressor LKB1, in association with accessory proteins STRAD and MO25, phosphorylates AMPKα at Thr172 in the activation loop, and this phosphorylation is required for AMPK activation. AMPKα is also phosphorylated at Thr258 and Ser485 (for α1; Ser491 for α2). The upstream kinase and the biological significance of these phosphorylation events have yet to be elucidated. The β1 subunit is post-translationally modified by myristoylation and multi-site phosphorylation including Ser24/25, Ser96, Ser101, Ser108, and Ser182. Phosphorylation at Ser108 of the β1 subunit seems to be required for the activation of AMPK enzyme, while phosphorylation at Ser24/25 and Ser182 affects AMPK localization. Several mutations in AMPKγ subunits have been identified, most of which are located in the putative AMP/ATP binding sites (CBS or Bateman domains). Mutations at these sites lead to reduction of AMPK activity and cause glycogen accumulation in heart or skeletal muscle. Accumulating evidence indicates that AMPK not only regulates the metabolism of fatty acids and glycogen, but also modulates protein synthesis and cell growth through EF2 and TSC2/mTOR pathways, as well as blood flow via eNOS/nNOS.
Product Details
Description Full length Clone DNA of Mouse protein kinase, AMP-activated, gamma 2 non-catalytic subunit with N terminal Flag tag.
NCBI Ref Seq XM_006535613.2
RefSeq ORF Size 1332 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.