Prkaca cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Prkaca cDNA ORF Clone, Mouse, N-HA tag

Prkaca cDNA ORF Clone, Mouse, N-HA tag

SPD-11517

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse protein kinase, cAMP dependent, catalytic, alpha with N terminal HA tag.
Target Information
Species Mouse
Target Name PKA
Gene Abbr. Prkaca
Gene ID 18747
Full Name protein kinase, cAMP dependent, catalytic, alpha
Alias C, P, PKCD, Pk, Pkaca
Introduction The second messenger cyclic AMP (cAMP) activates cAMP-dependent protein kinase (PKA or cAPK) in mammalian cells and controls many cellular mechanisms such as gene transcription, ion transport, and protein phosphorylation. Inactive PKA is a heterotetramer composed of a regulatory subunit (R) dimer and a catalytic subunit (C) dimer. In this inactive state, the pseudosubstrate sequences on the R subunits block the active sites on the C subunits. Three C subunit isoforms (C-α, C-β, and C-γ) and two families of regulatory subunits (RI and RII) with distinct cAMP binding properties have been identified. The two R families exist in two isoforms, α and β (RI-α, RI-β, RII-α, and RII-β). Upon binding of cAMP to the R subunits, the autoinhibitory contact is eased and active monomeric C subunits are released. PKA shares substrate specificity with Akt (PKB) and PKC, which are characterized by an arginine at position -3 relative to the phosphorylated serine or threonine residue. Substrates that present this consensus sequence and have been shown to be phosphorylated by PKA are Bad (Ser155), CREB (Ser133), and GSK-3 (GSK-3α Ser21 and GSK-3β Ser9). In addition, combined knock-down of PKA C-α and -β blocks cAMP-mediated phosphorylation of Raf (Ser43 and Ser259). Autophosphorylation and phosphorylation by PDK-1 are two known mechanisms responsible for phosphorylation of the C subunit at Thr197.
Product Details
Description Full length Clone DNA of Mouse protein kinase, cAMP dependent, catalytic, alpha with N terminal HA tag.
NCBI Ref Seq NM_008854.3
RefSeq ORF Size 1056 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.