PRKAB1 Knockout Cell Line - CD BioSciences

service-banner

PRKAB1 Knockout Cell Line

PRKAB1 Knockout Cell Line

SPL-02788

Size Price
1 Unit Online Inquiry
Description
308bp insertion
Target Information
Target Name AMPK
Gene Abbr. PRKAB1
Gene ID 5564
Full Name protein kinase AMP-activated non-catalytic subunit beta 1
Alias AMPK, HAMPKb
Species Human
Genomic Locus chr12:119668368
Transcript NM_006253
WT Expression Level 25.94 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. The myristoylation and phosphorylation of this subunit have been shown to affect the enzyme activity and cellular localization of AMPK. This subunit may also serve as an adaptor molecule mediating the association of the AMPK complex. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 308bp insertion in a coding exon of PRKAB1.
Description 308bp insertion
Parental Cell Line C631
Guide RNA Sequence TGGAAGAGGTCGGCGTCTTC
PCR Primer Forward: AAGAGAACTCTTACAGGACCATCTG
Reverse: ATCATGGGCAATACCAGCAGTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.