Online Inquiry
PRKAB1 Knockout Cell Line
SPL-02785
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
110bp insertion |
Target Information | |
---|---|
Target Name | AMPK |
Gene Abbr. | PRKAB1 |
Gene ID | 5564 |
Full Name | protein kinase AMP-activated non-catalytic subunit beta 1 |
Alias | AMPK, HAMPKb |
Species | Human |
Genomic Locus | chr12:119668368 |
Transcript | NM_006253 |
WT Expression Level | 25.94 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. The myristoylation and phosphorylation of this subunit have been shown to affect the enzyme activity and cellular localization of AMPK. This subunit may also serve as an adaptor molecule mediating the association of the AMPK complex. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 110bp insertion in a coding exon of PRKAB1. |
Description | 110bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | TGGAAGAGGTCGGCGTCTTC |
PCR Primer |
Forward: AAGAGAACTCTTACAGGACCATCTG Reverse: ATCATGGGCAATACCAGCAGTG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.