Online Inquiry
PPP6R1 Knockout Cell Line
SPL-02776
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP6R1 |
| Gene Abbr. | PPP6R1 |
| Gene ID | 22870 |
| Full Name | protein phosphatase 6 regulatory subunit 1 |
| Alias | KIAA1115, PP6R1, SAP190, SAPS1 |
| Species | Human |
| Genomic Locus | chr19:55245594 |
| Transcript | NM_014931 |
| WT Expression Level | 12.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of PPP6R1. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGATGAGTCCCTTCTGAAC |
| PCR Primer |
Forward: GTCCACGAAGTCATCCTTCTTCC Reverse: CTAGGATGGGATGGTTGGGTGTTAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.