PPP6R1 Knockout Cell Line - CD BioSciences

service-banner

PPP6R1 Knockout Cell Line

PPP6R1 Knockout Cell Line

SPL-02775

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name PPP6R1
Gene Abbr. PPP6R1
Gene ID 22870
Full Name protein phosphatase 6 regulatory subunit 1
Alias KIAA1115, PP6R1, SAP190, SAPS1
Species Human
Genomic Locus chr19:55245594
Transcript NM_014931
WT Expression Level 12.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of PPP6R1.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence CTGATGAGTCCCTTCTGAAC
PCR Primer Forward: GTCCACGAAGTCATCCTTCTTCC
Reverse: CTAGGATGGGATGGTTGGGTGTTAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.