PPP5C Knockout Cell Line - CD BioSciences

service-banner

PPP5C Knockout Cell Line

PPP5C Knockout Cell Line

SPL-02774

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name PPP5C
Gene Abbr. PPP5C
Gene ID 5536
Full Name protein phosphatase 5 catalytic subunit
Alias PP5, PPP5, PPT
Species Human
Genomic Locus chr19:46353845
Transcript NM_006247
WT Expression Level 136.78 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PPP5C.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence AGCCATAGCACTCAGTGCGC
PCR Primer Forward: CCTCATGCCTCTTCTTCTGTCTC
Reverse: GGTAAGTAGAGGAGTGAATGGCTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.