PPP4R4 Knockout Cell Line - CD BioSciences

service-banner

PPP4R4 Knockout Cell Line

PPP4R4 Knockout Cell Line

SPL-02771

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name PPP4R4
Gene Abbr. PPP4R4
Gene ID 57718
Full Name protein phosphatase 4 regulatory subunit 4
Alias CFAP14, KIAA1622, PP4R4
Species Human
Genomic Locus chr14:94208523
Transcript NM_020958
WT Expression Level 10.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of PPP4R4.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence AGAATCCCACTGAGACGCTT
PCR Primer Forward: AGTGCTTAACATTCAAAGCAGTCAT
Reverse: CTCCATTTCCATCAGCTAATTTCCC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.