Online Inquiry
PPP4R2 Knockout Cell Line
SPL-02770
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP4R2 |
| Gene Abbr. | PPP4R2 |
| Gene ID | 151987 |
| Full Name | protein phosphatase 4 regulatory subunit 2 |
| Alias | PP4R2 |
| Species | Human |
| Genomic Locus | chr3:73064037 |
| Transcript | NM_174907 |
| WT Expression Level | 105.36 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a regulatory subunit of the serine/threonine-protein phosphatase 4 complex. In addition to being required for efficient DNA double strand break repair, this complex plays a role in organization of microtubules at centrosomes and processing of spliceosomal snRNPs. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PPP4R2. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAACCTTTGGTCGATTAAG |
| PCR Primer |
Forward: CAAAGTTGCAGCAAATACTTCTGTG Reverse: ATAAACCGCATGAAAACCTTGTTCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.