Online Inquiry
PPP4R1 Knockout Cell Line
SPL-02767
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP4R1 |
| Gene Abbr. | PPP4R1 |
| Gene ID | 9989 |
| Full Name | protein phosphatase 4 regulatory subunit 1 |
| Alias | MEG1, PP4(Rmeg), PP4R1 |
| Species | Human |
| Genomic Locus | chr18:9595063 |
| Transcript | NM_001042388 |
| WT Expression Level | 54.66 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PPP4R1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATGAAATGTTGACGCCCCT |
| PCR Primer |
Forward: TAAAACTTGGTGACTCAGATTGTGC Reverse: GGCAAGGGGTACATTTTAGTTTCAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.