PPP3R2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PPP3R2 cDNA ORF Clone, Human, untagged

PPP3R2 cDNA ORF Clone, Human, untagged

SPD-11851

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein phosphatase 3, regulatory subunit B, beta
Target Information
Species Human
Target Name PPP3R2
Gene Abbr. PPP3R2
Gene ID 5535
Full Name protein phosphatase 3 regulatory subunit B, beta
Alias PPP3RL
Product Details
Description Full length Clone DNA of Human protein phosphatase 3, regulatory subunit B, beta
NCBI Ref Seq NM_147180.3
RefSeq ORF Size 522 bp
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.