PPP3CC Knockout Cell Line - CD BioSciences

service-banner

PPP3CC Knockout Cell Line

PPP3CC Knockout Cell Line

SPL-02765

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name Calcineurin A
Gene Abbr. PPP3CC
Gene ID 5533
Full Name protein phosphatase 3 catalytic subunit gamma
Alias CALNA3, CNA3, PP2Bgamma
Species Human
Genomic Locus chr8:22475565
Transcript NM_001243975
WT Expression Level 18.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Calcineurin is a calcium-dependent, calmodulin-stimulated protein phosphatase involved in the downstream regulation of dopaminergic signal transduction. Calcineurin is composed of a regulatory subunit and a catalytic subunit. The protein encoded by this gene represents one of the regulatory subunits that has been found for calcineurin. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PPP3CC.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence AAGAGGTAGCGTGTGTTACT
PCR Primer Forward: GTAATGCCCTTCGTCTTCTAAGGTA
Reverse: AGCCTATTTGTCAGATTTTCGACTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.