PPP3CC cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PPP3CC cDNA ORF Clone, Human, untagged

PPP3CC cDNA ORF Clone, Human, untagged

SPD-01944

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein phosphatase 3, catalytic subunit, gamma isozyme
Target Information
Species Human
Target Name Calcineurin A
Gene Abbr. PPP3CC
Gene ID 5533
Full Name protein phosphatase 3 catalytic subunit gamma
Alias CALNA3, CNA3, PP2Bgamma
Product Details
Description Full length Clone DNA of Human protein phosphatase 3, catalytic subunit, gamma isozyme
NCBI Ref Seq NM_001243974.1
RefSeq ORF Size 1566 bp
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.