PPP3CA cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PPP3CA cDNA ORF Clone, Human, untagged

PPP3CA cDNA ORF Clone, Human, untagged

SPD-01941

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 1.
Target Information
Species Human
Target Name Calcineurin A
Gene Abbr. PPP3CA
Gene ID 5530
Full Name protein phosphatase 3 catalytic subunit alpha
Alias ACCIID, CALN, CALNA, CALNA1, CCN1
Introduction Calcineurin, also known as protein phosphatase 2B (PP2B), is a calmodulin-dependent, calcium-activated, serine/threonine protein phosphatase composed of a catalytic subunit (calcineurin A) and a tightly bound regulatory subunit (calcineurin B). Calcineurin A is highly homologous to protein phosphatases 1 and 2A. Calcineurin B, like calmodulin, contains four EF-hand, calcium-binding motifs.Calcineurin signaling has been implicated in a broad spectrum of cellular processes including cell-cycle regulation, stress response and apoptosis and is required for proper cardiovascular and skeletal muscle development. Calcineurin-mediated dephosphorylation of the nuclear factor of activated T cells (NFAT) transcription factor is essential for NFAT activation and nuclear translocation and early gene expression in T lymphocytes. Calcineurin is the target of the immunosuppressive drugs Cyclosporin A and FK506, both of which block the activation of quiescent T cells after T cell receptor engagement. Cyclosporin A and FK506 bind to the immunophilins, cyclophilin and FKBP respectively and the immunophilin-drug complex binds to calcineurin and blocks substrate binding.
Product Details
Description Full length Clone DNA of Human protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 1.
NCBI Ref Seq NM_000944.4
RefSeq ORF Size 1566 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (pCMV3-untagged-HindIII-XbaI)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.