Online Inquiry
PPP3CA cDNA ORF Clone, Human, C-FLAG tag
SPD-01922
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 2 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Calcineurin A |
Gene Abbr. | PPP3CA |
Gene ID | 5530 |
Full Name | protein phosphatase 3 catalytic subunit alpha |
Alias | ACCIID, CALN, CALNA, CALNA1, CCN1 |
Introduction | Calcineurin, also known as protein phosphatase 2B (PP2B), is a calmodulin-dependent, calcium-activated, serine/threonine protein phosphatase composed of a catalytic subunit (calcineurin A) and a tightly bound regulatory subunit (calcineurin B). Calcineurin A is highly homologous to protein phosphatases 1 and 2A. Calcineurin B, like calmodulin, contains four EF-hand, calcium-binding motifs.Calcineurin signaling has been implicated in a broad spectrum of cellular processes including cell-cycle regulation, stress response and apoptosis and is required for proper cardiovascular and skeletal muscle development. Calcineurin-mediated dephosphorylation of the nuclear factor of activated T cells (NFAT) transcription factor is essential for NFAT activation and nuclear translocation and early gene expression in T lymphocytes. Calcineurin is the target of the immunosuppressive drugs Cyclosporin A and FK506, both of which block the activation of quiescent T cells after T cell receptor engagement. Cyclosporin A and FK506 bind to the immunophilins, cyclophilin and FKBP respectively and the immunophilin-drug complex binds to calcineurin and blocks substrate binding. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 2 with C terminal Flag tag. |
NCBI Ref Seq | NM_001130691.1 |
RefSeq ORF Size | 1536 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.