Online Inquiry
PPP2R5C Knockout Cell Line
SPL-02757
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | PPP2R5C |
| Gene Abbr. | PPP2R5C |
| Gene ID | 5527 |
| Full Name | protein phosphatase 2 regulatory subunit B'gamma |
| Alias | B56G, B56gamma, PR61G |
| Species | Human |
| Genomic Locus | chr14:101882205 |
| Transcript | NM_178587 |
| WT Expression Level | 153.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of PPP2R5C. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TACGGGAGCGGAATTTGACC |
| PCR Primer |
Forward: AAGCGGCTACTGTTAGAATTACCTA Reverse: TGTAAAGTGGTCAAACACACACATT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.