Online Inquiry
PPP2R1B Knockout Cell Line
SPL-02746
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
8bp deletion |
Target Information | |
---|---|
Target Name | PPP2R1B |
Gene Abbr. | PPP2R1B |
Gene ID | 5519 |
Full Name | protein phosphatase 2 scaffold subunit Abeta |
Alias | PP2A-Abeta, PR65B |
Species | Human |
Genomic Locus | chr11:111755344 |
Transcript | NM_002716 |
WT Expression Level | 54.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PPP2R1B. |
Description | 8bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TCTGCTGCTTGTCGAAGTGT |
PCR Primer |
Forward: AGAAACTTTGGGTACAACAGCAAAT Reverse: CTATATAAGGTGTGGCAGTCTTGGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.