Online Inquiry
PPP2CB Knockout Cell Line
SPL-02744
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | PPP2CB |
| Gene Abbr. | PPP2CB |
| Gene ID | 5516 |
| Full Name | protein phosphatase 2 catalytic subunit beta |
| Alias | PP2Abeta, PP2CB |
| Species | Human |
| Genomic Locus | chr8:30797641 |
| Transcript | NM_001009552 |
| WT Expression Level | 82.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes a beta isoform of the catalytic subunit. [provided by RefSeq, Mar 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of PPP2CB. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGTATGGGAATGCCAACGTT |
| PCR Primer |
Forward: GTCATATGAATCTAGACCCCAGCTT Reverse: GGTTTTACTCCTTTTCTTCCAGGTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.