PPP2CB Knockout Cell Line - CD BioSciences

service-banner

PPP2CB Knockout Cell Line

PPP2CB Knockout Cell Line

SPL-02743

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name PPP2CB
Gene Abbr. PPP2CB
Gene ID 5516
Full Name protein phosphatase 2 catalytic subunit beta
Alias PP2Abeta, PP2CB
Species Human
Genomic Locus chr8:30797641
Transcript NM_001009552
WT Expression Level 82.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes a beta isoform of the catalytic subunit. [provided by RefSeq, Mar 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PPP2CB.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence AGTATGGGAATGCCAACGTT
PCR Primer Forward: GTCATATGAATCTAGACCCCAGCTT
Reverse: GGTTTTACTCCTTTTCTTCCAGGTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.