Online Inquiry
PPP2CA cDNA ORF Clone, Rabbit, C-FLAG tag
SPD-11724
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rabbit protein phosphatase 2, catalytic subunit, alpha isozyme with C terminal Flag tag. |
Target Information | |
---|---|
Species | Rabbit |
Target Name | PP2A |
Gene Abbr. | PPP2CA |
Gene ID | 100009252 |
Full Name | protein phosphatase 2 catalytic subunit alpha |
Introduction | Protein phosphatase type 2A (PP2A) is an essential protein serine/threonine phosphatase that is conserved in all eukaryotes. PP2A is a key enzyme within various signal transduction pathways as it regulates fundamental cellular activities such as DNA replication, transcription, translation, metabolism, cell cycle progression, cell division, apoptosis and development. The core enzyme consists of catalytic C and regulatory A (or PR65) subunits, with each subunit represented by α and β isoforms. Additional regulatory subunits belong to four different families of unrelated proteins. Both the B (or PR55) and B' regulatory protein families contain α, β, γ and δ isoforms, with the B' family also including an ε protein. B'' family proteins include PR72, PR130, PR59 and PR48 isoforms, while striatin (PR110) and SG2NA (PR93) are both members of the B''' regulatory protein family. These B subunits competitively bind to a shared binding site on the core A subunit. This variable array of holoenzyme components, particularly regulatory B subunits, allows PP2A to act in a diverse set of functions. PP2A function is regulated by expression, localization, holoenzyme composition and post-translational modification. Phosphorylation of PP2A at Tyr307 by Src occurs in response to EGF or insulin and results in a substantial reduction of PP2A activity. Reversible methylation on the carboxyl group of Leu309 of PP2A has been observed. Methylation alters the conformation of PP2A, as well as its localization and association with B regulatory subunits. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rabbit protein phosphatase 2, catalytic subunit, alpha isozyme with C terminal Flag tag. |
NCBI Ref Seq | NM_001101686.1 |
RefSeq ORF Size | 930 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.