PPP2CA cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

PPP2CA cDNA ORF Clone, Human, C-His tag

PPP2CA cDNA ORF Clone, Human, C-His tag

SPD-11735

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein phosphatase 2, catalytic subunit, alpha isozyme with C terminal His tag.
Target Information
Species Human
Target Name PP2A
Gene Abbr. PPP2CA
Gene ID 5515
Full Name protein phosphatase 2 catalytic subunit alpha
Alias NEDLBA, PP2Ac, PP2CA, PP2Calpha, RP-C
Introduction Protein phosphatase type 2A (PP2A) is an essential protein serine/threonine phosphatase that is conserved in all eukaryotes. PP2A is a key enzyme within various signal transduction pathways as it regulates fundamental cellular activities such as DNA replication, transcription, translation, metabolism, cell cycle progression, cell division, apoptosis and development. The core enzyme consists of catalytic C and regulatory A (or PR65) subunits, with each subunit represented by α and β isoforms. Additional regulatory subunits belong to four different families of unrelated proteins. Both the B (or PR55) and B' regulatory protein families contain α, β, γ and δ isoforms, with the B' family also including an ε protein. B'' family proteins include PR72, PR130, PR59 and PR48 isoforms, while striatin (PR110) and SG2NA (PR93) are both members of the B''' regulatory protein family. These B subunits competitively bind to a shared binding site on the core A subunit. This variable array of holoenzyme components, particularly regulatory B subunits, allows PP2A to act in a diverse set of functions. PP2A function is regulated by expression, localization, holoenzyme composition and post-translational modification. Phosphorylation of PP2A at Tyr307 by Src occurs in response to EGF or insulin and results in a substantial reduction of PP2A activity. Reversible methylation on the carboxyl group of Leu309 of PP2A has been observed. Methylation alters the conformation of PP2A, as well as its localization and association with B regulatory subunits.
Product Details
Description Full length Clone DNA of Human protein phosphatase 2, catalytic subunit, alpha isozyme with C terminal His tag.
NCBI Ref Seq NM_002715.2
RefSeq ORF Size 930 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.