Online Inquiry
PPP1R9A Knockout Cell Line
SPL-02740
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
122bp deletion |
Target Information | |
---|---|
Target Name | PPP1R9A |
Gene Abbr. | PPP1R9A |
Gene ID | 55607 |
Full Name | protein phosphatase 1 regulatory subunit 9A |
Alias | NRB1, NRBI, Neurabin-I |
Species | Human |
Genomic Locus | chr7:94910345 |
Transcript | NM_017650 |
WT Expression Level | 4.97 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 122bp deletion in a coding exon of PPP1R9A. |
Description | 122bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATGACTGCAGCATTCTCGTT |
PCR Primer |
Forward: CTGAAAAGTACCTTTGACAAACCCA Reverse: TCTCAAACATCTTTCGAGTCTCAGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.